<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20130521//EN"
"http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd">
<article article-type="research-article" dtd-version="3.0" xml:lang="en"
	xmlns:xlink="http://www.w3.org/1999/xlink">
	<front>
		<journal-meta>
			<journal-id journal-id-type="publisher-id">JORM</journal-id>
			<journal-title-group>
				<journal-title>Journal of Oral &amp; Maxillofacial Research</journal-title>
			</journal-title-group>
			<issn pub-type="epub">2029-283X</issn>
			<publisher>
				<publisher-name>Stilus Optimus</publisher-name>
				<publisher-loc>Kaunas, Lithuania</publisher-loc>
			</publisher>
		</journal-meta>
		<article-meta>
			<article-id pub-id-type="publisher-id">v1n1e4ht</article-id>
			<article-id pub-id-type="doi">10.5037/jomr.2010.1104</article-id>
			<article-categories>
				<subj-group subj-group-type="article-type">
					<subject>Original Paper</subject>
				</subj-group>
			</article-categories>
			<title-group>
				<article-title>Early Effects of P-15 on Human Bone Marrow Stem Cells</article-title>
			</title-group>
			<contrib-group>
				<contrib contrib-type="author" id="contrib1">
					<name>
						<surname>Sollazzo</surname>
						<given-names>Vincenzo</given-names>
					</name>
					<xref ref-type="aff" rid="aff1">1</xref>
				</contrib>
				<contrib contrib-type="author" id="contrib2">
					<name>
						<surname>Palmieri</surname>
						<given-names>Annalisa</given-names>
					</name>
					<xref ref-type="aff" rid="aff2">2</xref>
				</contrib>
				<contrib contrib-type="author" id="contrib3">
					<name>
						<surname>Girardi</surname>
						<given-names>Ambra</given-names>
					</name>
					<xref ref-type="aff" rid="aff2">2</xref>
				</contrib>
				<contrib contrib-type="author" id="contrib4">
					<name>
						<surname>Farinella</surname>
						<given-names>Francesca</given-names>
					</name>
					<xref ref-type="aff" rid="aff3">3</xref>
				</contrib>
				<contrib contrib-type="author" id="contrib5" corresp="yes">
					<name>
						<surname>Carinci</surname>
						<given-names>Francesco</given-names>
					</name>
					<xref ref-type="aff" rid="aff3">3</xref>
				</contrib>
			</contrib-group>
            <aff id="aff1" rid="aff1">
			<sup>1</sup>
			<institution>Orthopedic Clinic, University of Ferrara, Ferrara</institution>
			<country>Italy.</country></aff>
            <aff id="aff2" rid="aff2">
			<sup>2</sup>
			<institution>Department of Histology, Embryology and Applied Biology, University of Bologna, Bologna</institution>
			<country>Italy.</country></aff>
			<aff id="aff3" rid="aff3">
			<sup>3</sup>
			<institution>Department of Maxillofacial Surgery, University of Ferrara, Ferrara</institution>
			<country>Italy.</country></aff>
			<author-notes>
				<corresp>Francesco Carinci, 
				<institution>Department of Maxillofacial Surgery, University of Ferrara</institution>
				<addr-line>University of Ferrara Corso Giovecca 203 IT – 44100, Ferrara</addr-line>
				<country>Italy</country>
				<phone>0039-0532-455582</phone>Fax: 0039-0532-455582<email>crc@unife.it</email>
				</corresp>
			</author-notes>
			<pub-date pub-type="collection">
			<season>Jan-Mar</season>
			<year>2010</year>
			</pub-date>
			<pub-date pub-type="epub">
				<day>1</day>
				<month>4</month>
				<year>2010</year>
				</pub-date>
			<volume>1</volume>
			<issue>1</issue>
			<elocation-id>e4</elocation-id>
				<history>
				<date date-type="received">
				<day>30</day>
				<month>10</month>
				<year>2009</year>
				</date>
				<date date-type="accepted">
				<day>26</day>
				<month>11</month>
				<year>2009</year>
				</date>
				</history>
			<permissions>
				<copyright-statement> Copyright &#169; Sollazzo V, Palmieri A, Girardi A, Farinella F, Carinci F. Published in the JOURNAL OF ORAL &amp; MAXILLOFACIAL RESEARCH
					(http://www.ejomr.org), 1 April 2010.</copyright-statement>
				<copyright-year>2010</copyright-year>
				<license license-type="open-access"
					xlink:href="http://creativecommons.org/licenses/by-nc-nd/3.0/">
					<license-p>This is an open-access article, first published in the JOURNAL OF
						ORAL &amp; MAXILLOFACIAL RESEARCH, distributed under the terms of the
						Creative Commons Attribution-Noncommercial-No Derivative Works 3.0 Unported
						License (http://creativecommons.org/licenses/by-nc-nd/3.0/), which permits unrestricted non-commercial use, distribution, and
						reproduction in any medium, provided the original work and is properly
						cited. The copyright, license information and link to the original
						publication on http://www.ejomr.org must be included.</license-p>
				</license>
			</permissions>
			<self-uri xlink:href="http://www.ejomr.org/JOMR/archives/2010/1/e4/e4ht.htm"
				xlink:type="simple"/>
			<abstract>
			<title>ABSTRACT</title>
				<sec sec-type="objectives">
					<title>Objectives</title>
					<p>Peptide-15 (P-15) is an analogue of the cell binding domain of collagen. 
		P-15 has been shown to facilitate physiological to process in a way 
		similar to collagen, to serve as anchorage for cells, and to promote the 
		binding, migration and differentiation of cells. However, how P-15 
		alters osteoblast activity to promote bone formation is poorly 
		understood. To study the osteoinductive properties of peptide P-15, we 
		analyzed the expression levels of bone related genes in human 
		mesenchymal stem cells treated with this biomaterial.</p>
				</sec>
				<sec sec-type="material and methods">
					<title>Material and Methods</title>
					<p>Using real time Reverse Transcription-Polymerase Chain Reaction the 
		quantitative expression of specific genes, like transcriptional factors 
		(RUNX2 and SP7), bone related genes (SPP1, COL1A1, COL3A1, BGLAP, ALPL, 
		and FOSL1) and mesenchymal stem cells marker (ENG) were examined.</p>
				</sec>
				<sec sec-type="results">
					<title>Results</title>
					<p>P-15 causes a considerable 
		induction of osteoblast transcriptional factor like osterix (SP7) and of 
		the bone related genes osteopontin (SPP1) and osteocalcin (BGLAP). In 
		contrast the expression of endoglin (ENG) was markedly 
		decreased in stem cells treated with P-15 respect to untreated cells, 
		indicating the differentiation effect of this biomaterial on stem cells.</p>
				</sec>
				<sec sec-type="conclusions">
					<title>Conclusions</title>
					<p>The present study shows the effect of P-15 on mesenchymal stem cells in 
		the early differentiation stages: P-15 is an inducer of osteogenesis on 
		human stem cells as indicated by the activation of bone related markers 
		SP7, SPP1 and BGLAP.The results may allow a better understanding of the molecular mechanism of 
		bone regeneration and as a model for comparing other materials with 
		similar clinical effects.</p>
				</sec>
			</abstract>
			<kwd-group>
				<kwd>stem cells</kwd>
				<kwd>biomaterial</kwd>
				<kwd>P-15</kwd>
				<kwd>differentiation</kwd>
				<kwd>bone.</kwd>
			</kwd-group>
		</article-meta>
	</front>
	<body>
		<sec sec-type="intro">
			<title>INTRODUCTION</title>
<p>Several studies have been involved in the identification of factors that could 
help in the regeneration of missing tissue [<xref ref-type="bibr" rid="B1">1</xref>]. One avenue of 
research has been the identification of the specific cell-binding domain of type 
I collagen [<xref ref-type="bibr" rid="B1">1</xref>]. Type I collagen represents approximately one third 
of the total body proteins. Collagen, moreover, is a major determinant of the architecture 
and tensile strength of the tissues, and it modulates cell proliferation, migration, 
differentiation, and specific gene expression [<xref ref-type="bibr" rid="B2">2</xref>]. P-15 is a highly 
conserved linear peptide with a 15-amino acid sequence identical to the sequence 
contained in the residues 766-780 of the alpha chain of type I collagen [<xref ref-type="bibr" rid="B1">1</xref>]. 
P-15 from DENTSPLY Friadent (CeraMed, Lakewood, CO, USA) is an analogue of the cell-binding 
domain of collagen [<xref ref-type="bibr" rid="B2">2</xref>]. P-15 competes for cell surface sites for 
attachment of collagen and, when immobilized on surfaces, it promotes adhesion of 
cells [<xref ref-type="bibr" rid="B3">3</xref>]. P-15 has been shown to facilitate physiological processes 
in a way similar to collagen, to facilitate the exchange of mechanical signals, 
and to promote cell differentiation [<xref ref-type="bibr" rid="B4">4-6</xref>]. Like other bone augmentation 
materials, P-15 associated with anorganic-derived bone matrix (ABM), has been shown 
to be helpful in the treatment of periodontal defects, and sinus-lifting procedures 
[<xref ref-type="bibr" rid="B1">1</xref>,<xref ref-type="bibr" rid="B7">7-11</xref>].</p>
<p>In previous studies a genome wide screening of osteoblast-like cell line (MG-63) 
following treatment with P-15 was performed by using cDNA microarray [<xref ref-type="bibr" rid="B12">12</xref>]. 
Several genes covering a broad range of functional activities, like signalling transduction, 
differentiation, apoptosis, cell-cycle regulation, were significantly up- or down-regulated 
[<xref ref-type="bibr" rid="B12">12</xref>]. Then the genetic effect of P-15 was studied in the same 
cell system at post-transcriptional level, with microRNA microarray [<xref ref-type="bibr" rid="B13">13</xref>,<xref ref-type="bibr" rid="B14">14</xref>]. 
A miRNA that regulates the transduction of genes related to bone formation (TFIP11), 
skeletal development (HOXD13, AEBP1, SHOX EN1 COMP SUFU IGF1 MATN1) and cartilage 
remodelling (NOG) was identified.</p>
<p>Because few reports analyze the effects of P-15 on stem cells [<xref ref-type="bibr" rid="B15">15</xref>] 
and none focus on the genetic effects, the expression of genes related to the osteoblast 
differentiation were analyzed using cultures of bone marrow derived human mesenchymal 
stem cells (BM-hMSCs) treated with P-15 for seven days, in order to detect the early 
effects of the common path of BMPs on stem cells.</p>
		</sec>
	<sec sec-type="materials|methods">
			<title>MATERIAL AND METHODS</title>
<p>The study was approved by the Ethics Committee of the Ferrara.</p>
<p><bold>Stem cell preparation</bold></p>
<p>Bone marrow derived human mesenchymal stem cells (BM-hMSCs) were obtained from 
the three healthy adult volunteers. There were 2 males and 1 female (average age 
of volunteers was 45 years); experiments were done in duplicate.</p>
<p>Bone Marrow collected in heparinized tubes, was diluted 1 : 3 with phosphate 
buffered saline (PBS) (Lonza, Basel, Switzerland) and layered over a Ficoll-Histopaque 
gradient (1.077 g/ml; Sigma, St. Louis, MO, USA). The low-density mononuclear cells 
were washed twice in PBS, counted and plated at 106/cm<sup>2 </sup>in cell culture 
flasks (BD Falcon, Bedford, MA, USA) in Dulbecco&#39;s Modified Eagle&#39;s Medium (DMEM) 
(Lonza, Basel, Switzerland) supplemented with 20% heat inactivated fetal bovine 
serum (FBS) (Lonza, Basel, Switzerland) and antibiotics (100 U/ml Penicillin, 100 
&#181;g/ml Streptomycin) (Sigma-Aldrich, Inc., St Louis, Mo, USA), and incubated at 37 
&#176;C in a humidified atmosphere with 5% CO<sub>2</sub>. After 1 week, the non-adherent 
cells were removed by replacing the medium supplemented with 10% FBS. When the cultures 
were near confluence (after 2 weeks) the cells were recovered, by treatment with 
1X trypsin/EDTA solution (Sigma-Aldrich, Inc., St Louis, Mo, USA), for cytometric 
analysis and functional assays. BM-hMSCs were maintained and subcultured for up 
to 10 - 15 passages.</p>
<p><bold>Immunofluorescence</bold></p>
<p>Cells were washed with PBS for three times and fixed with cold methanol for 5 
min at room temperature. After washing with PBS, cells were blocked with bovine 
albumin 3% (Sigma-Aldrich, Inc., St Louis, Mo, USA) for 30 min at room temperature. 
The cells were incubated overnight sequentially at 4 &#176;C with primary antibodies 
raised against CD105 1 : 200, mouse (BD Biosciences, San Jose, CA, USA), CD73 1 
: 200, mouse (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), CD90 1 : 200, 
mouse (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), CD34 1 : 200, mouse 
(Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA). They were washed with PBS 
and incubated for 1 h at room temperature with secondary antibody conjugated-Rodamine 
goat anti-mouse 1 : 200 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA). Subsequently, 
cells were mounted with the Vectashield Mounting Medium with DAPI (Vector Laboratories, 
Inc., Burlingame, CA, USA) and observed under a fluorescence microscope (Eclipse 
TE 2000-E, Nikon Instruments S.p.a., Florence, Italy).</p>
<p><bold>Cell culture</bold></p>
<p>BM-hMSCs at fourth passage were grown in medium (Alphamem-Sigma Aldrich, Inc., 
St Louis, Mo, USA) supplemented with 10% fetal calf serum, antibiotics (Penicillin 
100 U/ml and Streptomycin 100 &#181;g/ml – Sigma-Aldrich, Inc., St Louis, Mo, USA) and 
amminoacids (L-Glutamine – Sigma-Aldrich, Inc., St Louis, Mo, USA). The cultures 
were maintained in a 5% CO<sub>2</sub> humidified atmosphere at 37 &#176;C.</p>
<p>For the assay, cells were collected and seeded at a density of 1 x 105 cells/ml 
into 9 cm<sup>2</sup> (3 ml) wells by using 0.1% trypsin, 0.02% EDTA in Ca++ - and 
Mg - free Eagle&#39;s buffer for cell release.</p>
<p>One set of wells were added with P-15 at the concentration of 10 &#181;l/ml. Another 
set of wells containing untreated cells were used as control. The medium was changed 
every 3 days.</p>
<p>After seven days, when cultures were subconfluent, cells were processed for RNA 
extraction.</p>
<p><bold>RNA processing</bold></p>
<p>Reverse transcription to cDNA was performed directly from cultured cell lysate 
using the TaqMAn Gene Expression Cells-to-Ct Kit (Ambion Inc., Austin, TX, USA), 
following manufacturer&#39;s instructions. Briefly, cultured cells were lysed with lysis 
buffer and RNA released in this solution. Cell lysate were reverse transcribed to 
cDNA using the RT Enzyme Mix and appropriate RT buffer (Ambion Inc., Austin, TX, 
USA).</p>
<p>Finally the cDNA was amplified by real time PCR using the included TaqMan Gene 
Expression Master Mix and the specific assay designed for the investigated genes</p>
<p><bold>Real time PCR</bold></p>
<p>Expression was quantified using real time RT-PCR. The gene expression levels 
were normalized to the expression of the housekeeping gene RPL13A and were expressed 
as fold changes relative to the expression of the untreated BM-hMSCs. Quantification 
was done with the delta/delta calculation method [<xref ref-type="bibr" rid="B16">16</xref>].</p>
<p>Forward and reverse primers and probes for the selected genes were designed using 
primer express software (Applied Biosystems, Foster City, CA, USA) and are listed 
in <xref ref-type="table" rid="T1">Table 1</xref>.</p>
			<table-wrap id="T1" position="float">
				<label>Table 1</label>
				<caption>
			  <p>Primer and probes used in real time PCR</p>
				</caption>
				<table frame="hsides" rules="groups">
  <thead>
  <tr> <th> Gene symbol </th> <th> Gene name </th> <th> Primer sequence (5’ &gt; 3’) </th> <th> Probe sequence (5’ &gt; 3’) </th> </tr>
  </thead> <tbody>
  <tr>
    <td> SPP1 </td>
    <td> osteopontin </td>
    <td> F-GCCAGTTGCAGCCTTCTCA<break />
      R-AAAAGCAAATCACTGCAATTCTCA </td>
    <td> CCAAACGCCGACCAAGGAAAACTCAC </td>
  </tr>
  <tr>
    <td colspan="4"><hr/></td>
  </tr>
  <tr>
    <td> COL1A1 </td>
    <td> collagen type I alpha1 </td>
    <td> F-TAGGGTCTAGACATGTTCAGCTTTGT<break />
      R-GTGATTGGTGGGATGTCTTCGT </td>
    <td> CCTCTTAGCGGCCACCGCCCT </td>
  </tr>
  <tr>
    <td colspan="4"><hr/></td>
  </tr>
  <tr>
    <td> RUNX2 </td>
    <td> runt-related transcription factor 2 </td>
    <td> F-TCTACCACCCCGCTGTCTTC<break />
      R-TGGCAGTGTCATCATCTGAAATG </td>
    <td> ACTGGGCTTCCTGCCATCACCGA </td>
  </tr>
  <tr>
    <td colspan="4"><hr/></td>
  </tr>
  <tr>
    <td> ALPL </td>
    <td> alkaline phosphatase </td>
    <td> F-CCGTGGCAACTCTATCTTTGG<break />
      R-CAGGCCCATTGCCATACAG </td>
    <td> CCATGCTGAGTGACACAGACAAGAAGCC </td>
  </tr>
  <tr>
    <td colspan="4"><hr/></td>
  </tr>
  <tr>
    <td> COL3A1 </td>
    <td> collagen, type III, alpha 1 </td>
    <td> F-CCCACTATTATTTTGGCACAACAG<break />
      R-AACGGATCCTGAGTCACAGACA </td>
    <td> ATGTTCCCATCTTGGTCAGTCCTATGCG </td>
  </tr>
  <tr>
    <td colspan="4"><hr/></td>
  </tr>
  <tr>
    <td> BGLAP </td>
    <td> osteocalcin </td>
    <td> F-CCCTCCTGCTTGGACACAAA<break />
      R-CACACTCCTCGCCCTATTGG </td>
    <td> CCTTTGCTGGACTCTGCACCGCTG </td>
  </tr>
  <tr>
    <td colspan="4"><hr/></td>
  </tr>
  <tr>
    <td> CD105 </td>
    <td> endoglin </td>
    <td> F-TCATCACCACAGCGGAAAAA<break />
      R-GGTAGAGGCCCAGCTGGAA </td>
    <td> TGCACTGCCTCAACATGGACAGCCT </td>
  </tr>
  <tr>
    <td colspan="4"><hr/></td>
  </tr>
  <tr>
    <td> FOSL1 </td>
    <td> FOS-like antigen 1 </td>
    <td> F-CGCGAGCGGAACAAGCT<break />
      R-GCAGCCCAGATTTCTCATCTTC </td>
    <td> ACTTCCTGCAGGCGGAGACTGACAAAC </td>
  </tr>
  <tr>
    <td colspan="4"><hr/></td>
  </tr>
  <tr>
    <td> SP7 </td>
    <td> osterix </td>
    <td> F-ACTCACACCCGGGAGAAGAA<break />
      R-GGTGGTCGCTTCGGGTAAA </td>
    <td> TCACCTGCCTGCTCTTGCTCCAAGC </td>
  </tr>
  <tr>
    <td colspan="4"><hr/></td>
  </tr>
  <tr>
    <td> RPL13A </td>
    <td> ribosomal protein L13 </td>
    <td> F-AAAGCGGATGGTGGTTCCT<break />
      R-GCCCCAGATAGGCAAACTTTC </td>
    <td> CTGCCCTCAAGGTCGTGCGTCTG </td>
  </tr>
  </tbody>
</table>
			</table-wrap>
<p>All PCR reactions were performed in a 20 &#181;l volume using the ABI PRISM 7500 (Applied 
Biosystems, Foster City, CA, USA). Each reaction contained 10 &#181;l 2X TaqMan universal 
PCR master mix (Applied Biosystems, Foster City, CA, USA), 400 nM concentration 
of each primer and 200 nM of the probe, and cDNA. The amplification profile was 
initiated by 10 minute incubation at 95 &#176;C, followed by two-step amplification of 
15 seconds at 95 &#176;C and 60 seconds at 60 &#176;C for 40 cycles. All experiments were 
performed including non-template controls to exclude reagents contamination. PCRs 
were performed with two biological replicates.</p>
		</sec>
		<sec sec-type="results">
			<title>RESULTS</title>
<p>BM-hMSCs were characterized by immunofluorescence. The cell surfaces were positive 
for mesenchymal stem cell marker, CD105, CD90 and CD73 and negative for markers 
of haematopoietic origin, CD34 (<xref ref-type="fig" rid="fig1">Figure 1</xref>).</p>
			<fig id="fig1">
				<label>Figure 1</label>
				<caption>
					<p>BM-hMSCs with indirect immunofluorescence 
		(Rodamine). Cultured cells were positive for the mesenchymal stem cell marker 
		CD73 (a), CD90 (b), CD105 (c) and negative for the hematopoietic markers 
		CD34 (d). Nuclei were stained with DAPI. Original magnification x40.</p>
				</caption>
				<graphic xlink:href="jomr-01-e4-g001.jpg"/>
			</fig>	
<p>Transcriptional expressions of several osteoblast-related genes (RUNX2, SP7, 
SPP1, COLIA1, COL3A1, BGLAP, ALPL and FOSL1) and mesenchymal stem cells marker (ENG) 
were examined after 7 days of supplement treatment with P-15 (10 &#181;l/ml).</p>
<p>Quantitative real time RT–PCR of SP7, SPP1, BGLAP showed a considerable induction 
after treatment with P-15. However, P-15 treatment did not affect the mRNA expression 
of RUNX2 and ALPL that were similarly in both treated and untreated BM-hMSCs. COL1A1, 
COL3A1 and FOSL1 were decreased in the presence of P-15 at day 7 like the stem cell 
marker ENG (<xref ref-type="fig" rid="fig2">Figure 2</xref>).</p>
			<fig id="fig2">
				<label>Figure 2</label>
				<caption>
					<p>Gene expression analysis of BM-hMSCs after 7 days of treatment with P-15.</p>
				</caption>
				<graphic xlink:href="jomr-01-e4-g002.jpg"/>
			</fig>
		</sec>
		<sec sec-type="discussion">
		  <title>DISCUSSION</title>
<p>In order to understand the action of P-15 on BM-hMSCs, changes in expression 
of bone related marker genes (RUNX2, SP7, SPP1, COLIA1, COL3A1, BGLAP, ALPL and 
FOSL1) and mesenchymal stem cells marker (ENG) were investigated by real time RT–PCR.</p>
<p>Mesenchymal stem cells are defined as self-renewable, multipotent progenitor 
cells with the ability to differentiate, under adequate stimuli, into several mesenchymal 
lineages, including osteoblasts [<xref ref-type="bibr" rid="B17">17</xref>].</p>
<p>In present study, mesenchymal stem cells from human bone marrow were isolated 
and characterized by morphology and immunophenotype. Isolated BM-hMSCs showed fibroblast-like 
morphology and were positive for MSC surface molecules (CD90, CD105, CD73) and negative 
for markers of haematopoietic progenitors (CD34).</p>
<p>Two osteoblast-specific genes, SPP1 and BGLAP, that are generally expressed by 
osteoblast in the early stage of their differentiation [<xref ref-type="bibr" rid="B18">18</xref>], 
were up-regulate in treated BM-hMSCs.</p>
<p>Another up-regulated gene was SP7, a zinc finger transcription factor that regulates 
bone formation and osteoblast differentiation <italic>in vitro</italic> and <italic>in vivo</italic> 
and that is expressed in the early stage of osteogenic differentiation.</p>
<p>ENG (CD105), a surface markers used to define a bone marrow stromal cell population 
capable of multilineage differentiation [<xref ref-type="bibr" rid="B19">19</xref>], was down-regulated 
in treated BM-hMSCs respect to control. There is an inverse correlation between 
CD105 expression and the differentiation status of MSC [<xref ref-type="bibr" rid="B20">20</xref>]. 
This gene is a receptor for TGF-&#946;1 and -&#946;3 [<xref ref-type="bibr" rid="B21">21</xref>] and modulates 
TGF-&#946; signalling by interacting with related molecules, such as TGF-&#946;1, -&#946;3, BMP-2, 
-7, and activin A. It is speculated that these members of the TFG-&#946; superfamily 
are mediators of cell proliferation and differentiation and play regulatory roles 
in cartilage and bone formation [<xref ref-type="bibr" rid="B22">22</xref>]. The disappearance of the 
CD105 antigen during osteogenesis suggests that this protein, like others in the 
TFG-&#946; superfamily, is involved in the regulation of osteogenesis [<xref ref-type="bibr" rid="B22">23</xref>].</p>
<p>Expression of RUNX2 and ALPL didn&#39;t have significant change in treated cells 
respect to control after 7 day of treatment with P-15. RUNX2 is the most specific 
osteoblast transcription factor and is a prerequisite for osteoblast differentiation 
and consequently mineralization. This result is comparable with data reported by 
Kim et al. [<xref ref-type="bibr" rid="B24">24</xref>]. They showed that there was no BMP-2-mediated 
up-regulation of RUNX2 mRNA expression at days 3 or 7, but BMP-2 treatment induced 
a significant and time dependent increase in SP7 mRNA expression [<xref ref-type="bibr" rid="B24">24</xref>].</p>
<p>Alkaline phosphatase regulates mineralization of bone matrix. Several studies 
demonstrated that the potency of individual substances to induce alkaline phosphatase 
varies in a species-dependent manner. Glucocorticoids such as dexamethasone are 
potent inducers in human and rat stromal cells, but they have no effect on alkaline 
phosphatase activity in mouse stromal cells [<xref ref-type="bibr" rid="B25">25</xref>,<xref ref-type="bibr" rid="B26">26</xref>]. Instead 
bone morphogenetic proteins (BMPs) are potent inducers of osteogenesis in both mouse 
and rat bone marrow stromal cells [<xref ref-type="bibr" rid="B27">27</xref>]. However, Diefenderfer 
et al. [<xref ref-type="bibr" rid="B28">28</xref>] showed that BMP-2 alone is a poor osteoblast inducer 
in human marrow derived stromal cells.</p>
<p>P-15 also modulates the expression of FOSL1 that encodes for Fra-1, a component 
of the dimeric transcription factor activator protein-1 (Ap-1), which is composed 
mainly of Fos (c-Fos, FosB, Fra-1 and Fra-2) and Jun proteins (c-Jun, JunB and JunD).</p>
<p>AP-1 sites are present in the promoters of many developmentally regulated osteoblast 
genes, including alkaline phosphatase, collagen I, osteocalcin (OC).</p>
<p>McCabe et al. [<xref ref-type="bibr" rid="B29">29</xref>] demonstrated that differential expression 
of Fos and Jun family members could play a role in the developmental regulation 
of bone-specific gene expression and, as a result, may be functionally significant 
for osteoblast differentiation.</p>
<p>In our study FOSL1 was down-regulated, probably because cells were at early stage 
of differentiation. Kim et al. [<xref ref-type="bibr" rid="B30">30</xref>] studying the effect of a new 
anabolic agents that stimulate bone formation, found that this gene was activated 
in the late stage of differentiation, during the calcium deposition.</p>
<p>P15 also modulates the expression of genes encoding for collagenic extracellular 
matrix proteins like collagen type 1&#945;1 (COL1A1) and collagen type 3&#945;1 (COL3A1). 
COL1A1, and COL3A1 were considerably down expressed as compared to the control when 
exposed to P15, probably because this gene are activated in the late stage of differentiation 
and are related to extracellular matrix synthesis.</p>
<p>The present study shows the effect of P-15 on BM-hMSCs in the early differentiation 
stages: P-15 is an inducer of osteogenesis on human stem cells but RUNX2 is not 
immediately activated. Moreover, we have chosen to perform the experiment after 
7 days in order to get information on the early stages of stimulation.</p>
<p>More investigations with several different time points are needed in order to 
understand the molecular events related to P-15 action. This model is useful to 
investigate the effects of a variety of substances on stem cells.</p>
	</sec>
		<sec sec-type="conclusions">
			<title>CONCLUSIONS</title>
<p>The results obtained showed that P-15 participates in the initial process of 
differentiation of BM-hMSCs into osteoblasts, inducing expression of factors related 
to the differentiation like SP7, SPP1 and BGLAP.</p>
		</sec>
	</body>
	<back>
		<ack>
			<sec sec-type="acknowledgments and disclosure statements">
				<title>ACKNOWLEDGMENTS AND DISCLOSURE STATEMENTS</title>
<p>The authors report no conflicts of interest related to this study.</p>
<p>This work was supported by FAR from the University of Ferrara (FC), Ferrara, 
Italy, and from Regione Emilia Romagna, Programma di Ricerca Regione Universit&#224;, 
2007–2009, Area 1B: Patologia osteoarticolare: ricerca pre-clinica e applicazioni 
cliniche della medicina rigenerativa, Unit&#224; Operativa n. 14.</p>
		 </sec>
		</ack>
		<ref-list>
		<title>REFERENCES</title>
            <ref id="B1"><label>1</label>
				<element-citation>
					<person-group person-group-type="author">
						<name>
							<surname>Yukna</surname>
							<given-names>RA</given-names>
                            </name><name>
                            <surname>Callan</surname>
							<given-names>DP</given-names>
                            </name><name>
                            <surname>Krauser</surname>
							<given-names>JT</given-names>
                            </name><name>
                            <surname>Evans</surname>
							<given-names>GH</given-names>
                            </name><name>
                            <surname>Aichelmann-Reidy</surname>
							<given-names>ME</given-names>
                            </name><name>
                            <surname>Moore</surname>
							<given-names>K</given-names>
                            </name><name>
                            <surname>Cruz</surname>
							<given-names>R</given-names>
                            </name><name>
                            <surname>Scott</surname>
							<given-names>JB</given-names>
						</name>
					</person-group>
					<source>Multi-center clinical evaluation of combination anorganic 
bovine-derived hydroxyapatite matrix (ABM)/cell binding peptide (P-15) as a bone 
replacement graft material in human periodontal osseous defects. 6-month results. 
J Periodontol. 1998 Jun;69(6):655-63.</source>
					<pub-id pub-id-type="pmid">9660334</pub-id>
</element-citation>
            </ref>
            <ref id="B2"><label>2</label>
				<element-citation>
					<person-group person-group-type="author">
						<name>
							<surname>Bhatnagar</surname>
							<given-names>RS</given-names>
                            </name><name>
                            <surname>Qian</surname>
							<given-names>JJ</given-names>
                            </name><name>
                            <surname>Gough</surname>
							<given-names>CA</given-names>
						</name>
					</person-group>
					<source>The role in cell binding 
of a beta-bend within the triple helical region in collagen alpha 1 (I) chain: structural 
and biological evidence for conformational tautomerism on fiber surface. J Biomol 
Struct Dyn. 1997 Apr;14(5):547-60.</source>
					<pub-id pub-id-type="pmid">9130077</pub-id>
</element-citation>
            </ref>
            <ref id="B3"><label>3</label>
				<element-citation>
					<person-group person-group-type="author">
						<name>
							<surname>Qian</surname>
							<given-names>JJ</given-names>
                            </name><name>
                            <surname>Bhatnagar</surname>
							<given-names>RS</given-names>
						</name>
					</person-group>
					<source>Enhanced cell attachment to anorganic 
bone mineral in the presence of a synthetic peptide related to collagen. J Biomed 
Mater Res. 1996 Aug;31(4):545-54</source>
					<pub-id pub-id-type="pmid">8836852</pub-id>
</element-citation>
            </ref>
            <ref id="B4"><label>4</label>
				<element-citation>
					<person-group person-group-type="author">
						<name>
							<surname>Bhatnagar</surname>
							<given-names>RS</given-names>
                            </name><name>
                            <surname>Qian</surname>
							<given-names>JJ</given-names>
                            </name><name>
                            <surname>Wedrychowska</surname>
							<given-names>A</given-names>
                            </name><name>
                            <surname>Sadeghi</surname>
							<given-names>M</given-names>
                            </name><name>
                            <surname>Wu</surname>
							<given-names>YM</given-names>
                            </name><name>
                            <surname>Smith</surname>
							<given-names>N</given-names>
						</name>
					</person-group>
					<source>Design of biomimetic habitats for tissue engineering with P-15, a synthetic 
peptide analogue of collagen. Tissue Eng. 1999 Feb;5(1):53-65.</source>
					<pub-id pub-id-type="pmid">10207189</pub-id>
</element-citation>
            </ref>
            <ref id="B5"><label>5</label>
				<element-citation>
					<person-group person-group-type="author">
						<name>
							<surname>Yang</surname>
							<given-names>XB</given-names>
                            </name><name>
                            <surname>Bhatnagar</surname>
							<given-names>RS</given-names>
                            </name><name>
                            <surname>Li</surname>
							<given-names>S</given-names>
                            </name><name>
                            <surname>Oreffo</surname>
							<given-names>RO</given-names>
						</name>
					</person-group>
					<source>Biomimetic collagen 
scaffolds for human bone cell growth and differentiation. Tissue Eng. 2004 Jul-Aug;10(7-8):1148-59.</source>
					<pub-id pub-id-type="pmid">15363171</pub-id>
</element-citation>
            </ref>
            <ref id="B6"><label>6</label>
				<element-citation>
					<person-group person-group-type="author">
						<name>
							<surname>Lallier</surname>
							<given-names>TE</given-names>
                            </name><name>
                            <surname>Yukna</surname>
							<given-names>R</given-names>
                            </name><name>
                            <surname>St Marie</surname>
							<given-names>S</given-names>
                            </name><name>
                            <surname>Moses</surname>
							<given-names>R</given-names>
						</name>
					</person-group>
					<source>The putative 
collagen binding peptide hastens periodontal ligament cell attachment to bone replacement 
graft materials. J Periodontol. 2001 Aug;72(8):990-7.</source>
					<pub-id pub-id-type="pmid">11526918</pub-id> 
<pub-id pub-id-type="doi">10.1902/jop.2001.72.8.990</pub-id>
</element-citation>
            </ref>
            <ref id="B7"><label>7</label>
				<element-citation>
					<person-group person-group-type="author">
						<name>
							<surname>Krauser</surname>
							<given-names>JT</given-names>
                            </name><name>
                            <surname>Rohrer</surname>
							<given-names>MD</given-names>
                            </name><name>
                            <surname>Wallace</surname>
							<given-names>SS</given-names>
						</name>
					</person-group>
					<source>Human histologic 
and histomorphometric analysis comparing OsteoGraf/N with PepGen P-15 in the maxillary 
sinus elevation procedure: a case report. Implant Dent. 2000;9(4):298-302.</source>
					<pub-id pub-id-type="pmid">H11307551</pub-id>
</element-citation>
            </ref>
            <ref id="B8"><label>8</label>
				<element-citation>
					<person-group person-group-type="author">
						<name>
							<surname>Yukna</surname>
							<given-names>R</given-names>
                            </name><name>
                            <surname>Salinas</surname>
							<given-names>TJ</given-names>
                            </name><name>
                            <surname>Carr</surname>
							<given-names>RF</given-names>
						</name>
					</person-group>
					<source>Periodontal regeneration 
following use of ABM/P-1 5: a case report. Int J Periodontics Restorative Dent. 
2002 Apr;22(2):146-55.</source>
					<pub-id pub-id-type="pmid">12019710</pub-id>
</element-citation>
            </ref>
            <ref id="B9"><label>9</label>
				<element-citation>
					<person-group person-group-type="author">
						<name>
							<surname>Yukna</surname>
							<given-names>RA</given-names>
                            </name><name>
                            <surname>Krauser</surname>
							<given-names>JT</given-names>
                            </name><name>
                            <surname>Callan</surname>
							<given-names>DP</given-names>
                            </name><name>
                            <surname>Evans</surname>
							<given-names>GH</given-names>
                            </name><name>
                            <surname>Cruz</surname>
							<given-names>R</given-names>
                            </name><name>
                            <surname>Martin </surname>
							<given-names>M</given-names>
						</name>
					</person-group>
					<source>Thirty-six month follow-up of 25 patients treated with combination anorganic 
bovine-derived hydroxyapatite matrix (ABM)/cell-binding peptide (P-15) bone replacement 
grafts in human infrabony defects. I. Clinical findings. J Periodontol. 2002 Jan;73(1):123-8.</source>
					<pub-id pub-id-type="pmid">11846193s</pub-id> 
<pub-id pub-id-type="doi">10.1902/jop.2002.73.1.123</pub-id>
</element-citation>
            </ref>
            <ref id="B10"><label>10</label>
				<element-citation>
					<person-group person-group-type="author">
						<name>
							<surname>Schilephake</surname>
							<given-names>H</given-names>
						</name>
					</person-group>
					<source>Bone growth factors in maxillofacial 
skeletal reconstruction. Int J Oral Maxillofac Surg. 2002 Oct;31(5):469-84. Review.</source>
					<pub-id pub-id-type="pmid">12418561</pub-id>
</element-citation>
            </ref>
            <ref id="B11"><label>11</label>
				<element-citation>
					<person-group person-group-type="author">
						<name>
							<surname>Barboza</surname>
							<given-names>EP</given-names>
                            </name><name>
                            <surname>de Souza</surname>
							<given-names>RO</given-names>
                            </name><name>
                            <surname>Ca&#250;la</surname>
							<given-names>AL</given-names>
                            </name><name>
                            <surname>Neto</surname>
							<given-names>LG</given-names>
                            </name><name>
                            <surname>Ca&#250;la Fde</surname>
							<given-names>O</given-names>
                            </name><name>
                            <surname>Duarte</surname>
							<given-names>ME</given-names>
						</name>
					</person-group>
					<source>Bone regeneration of localized chronic alveolar defects utilizing 
cell binding peptide associated with anorganic bovine-derived bone mineral: a clinical 
and histological study. J Periodontol. 2002 Oct;73(10):1153-9.</source>
					<pub-id pub-id-type="pmid">12416773</pub-id> 
<pub-id pub-id-type="doi">10.1902/jop.2002.73.10.1153</pub-id>
</element-citation>
            </ref>
            <ref id="B12"><label>12</label>
				<element-citation>
					<person-group person-group-type="author">
						<name>
							<surname>Carinci</surname>
							<given-names>F</given-names>
                            </name><name>
                            <surname>Pezzetti</surname>
							<given-names>F</given-names>
                            </name><name>
                            <surname>Volinia</surname>
							<given-names>S</given-names>
                            </name><name>
                            <surname>Laino</surname>
							<given-names>G</given-names>
                            </name><name>
                            <surname>Arcelli</surname>
							<given-names>D</given-names>
                            </name><name>
                            <surname>Caramelli</surname>
							<given-names>E</given-names>
                            </name><name>
                            <surname>Degidi</surname>
							<given-names>M</given-names>
                            </name><name>
                            <surname>Piattelli</surname>
							<given-names>A</given-names>
						</name>
					</person-group>
					<source>P-15 cell-binding domain derived from collagen: 
analysis of MG63 osteoblastic-cell response by means of a microarray technology. 
J Periodontol. 2004 Jan;75(1):66-83.</source>
					<pub-id pub-id-type="pmid">15025218</pub-id> 
<pub-id pub-id-type="doi">10.1902/jop.2004.75.1.66</pub-id>
</element-citation>
            </ref>
            <ref id="B13"><label>13</label>
				<element-citation>
					<person-group person-group-type="author">
						<name>
							<surname>Palmieri</surname>
							<given-names>A</given-names>
                            </name><name>
                            <surname>Pezzetti</surname>
							<given-names>F</given-names>
                            </name><name>
                            <surname>Brunelli</surname>
							<given-names>G</given-names>
                            </name><name>
                            <surname>Martinelli</surname>
							<given-names>M</given-names>
                            </name><name>
                            <surname>Lo Muzio</surname>
							<given-names>L</given-names>
                            </name><name>
                            <surname>Scarano</surname>
							<given-names>A</given-names>
                            </name><name>
                            <surname>Degidi</surname>
							<given-names>M</given-names>
                            </name><name>
                            <surname>Piattelli</surname>
							<given-names>A</given-names>
                            </name><name>
                            <surname>Carinci</surname>
							<given-names>F</given-names>
						</name>
					</person-group>
					<source>Peptide-15 changes miRNA 
expression in osteoblast-like cells. Implant Dent. 2008 Mar;17(1):100-8.</source>
					<pub-id pub-id-type="pmid">18332763</pub-id> 
<pub-id pub-id-type="doi">10.1097/ID.0b013e318166d182</pub-id>
</element-citation>
            </ref>
            <ref id="B14"><label>14</label>
				<element-citation>
					<person-group person-group-type="author">
						<name>
							<surname>Palmieri</surname>
							<given-names>A</given-names>
                            </name><name>
                            <surname>Pezzetti</surname>
							<given-names>F</given-names>
                            </name><name>
                            <surname>Brunelli</surname>
							<given-names>G</given-names>
                            </name><name>
                            <surname>Zollino</surname>
							<given-names>I</given-names>
                            </name><name>
                            <surname>Scapoli</surname>
							<given-names>L</given-names>
                            </name><name>
                            <surname>Martinelli</surname>
							<given-names>M</given-names>
                            </name><name>
                            <surname>Arlotti</surname>
							<given-names>M</given-names>
                            </name><name>
                            <surname>Carinci</surname>
							<given-names>F</given-names>
						</name>
					</person-group>
					<source>Differences in osteoblast miRNA induced by 
cell binding domain of collagen and silicate-based synthetic bone. J Biomed Sci. 
2007 Nov;14(6):777-82. Epub 2007 Jul 25.</source>
					<pub-id pub-id-type="pmid">17653614</pub-id>
</element-citation>
            </ref>
            <ref id="B15"><label>15</label>
				<element-citation>
					<person-group person-group-type="author">
						<name>
							<surname>Smiler</surname>
							<given-names>D</given-names>
                            </name><name>
                            <surname>Soltan</surname>
							<given-names>M</given-names>
                            </name><name>
                            <surname>Lee</surname>
							<given-names>JW</given-names>
						</name>
					</person-group>
					<source>A histomorphogenic analysis 
of bone grafts augmented with adult stem cells. Implant Dent. 2007 Mar;16(1):42-53.</source>
					<pub-id pub-id-type="pmid">17356371</pub-id> 
<pub-id pub-id-type="doi">10.1097/ID.0b013e3180335934</pub-id>
</element-citation>
            </ref>
            <ref id="B16"><label>16</label>
				<element-citation>
					<person-group person-group-type="author">
						<name>
							<surname>Livak</surname>
							<given-names>KJ</given-names>
                            </name><name>
                            <surname>Schmittgen</surname>
							<given-names>TD</given-names>
						</name>
					</person-group>
					<source>Analysis of relative gene 
expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. 
Methods. 2001 Dec;25(4):402-8.</source>
					<pub-id pub-id-type="pmid">11846609</pub-id> 
<pub-id pub-id-type="doi">10.1006/meth.2001.1262</pub-id>
</element-citation>
            </ref>
            <ref id="B17"><label>17</label>
				<element-citation>
					<person-group person-group-type="author">
						<name>
							<surname>Alhadlaq</surname>
							<given-names>A</given-names>
                            </name><name>
                            <surname>Mao</surname>
							<given-names>JJ</given-names>
						</name>
					</person-group>
					<source>Mesenchymal stem cells: isolation 
and therapeutics. Stem Cells Dev. 2004 Aug;13(4):436-48. Review.</source>
					<pub-id pub-id-type="pmid">15345137</pub-id> 
<pub-id pub-id-type="doi">10.1089/scd.2004.13.436</pub-id>
</element-citation>
            </ref>
            <ref id="B18"><label>18</label>
				<element-citation>
					<person-group person-group-type="author">
						<name>
							<surname>Lian</surname>
							<given-names>JB</given-names>
                            </name><name>
                            <surname>Stein</surname>
							<given-names>GS</given-names>
                            </name><name>
                            <surname>Aubin</surname>
							<given-names>JE</given-names>
						</name>
					</person-group>
					<source>Bone 
formation: maturation and functional activities of osteoblast lineage cells. In: 
MJ Favus, editor. Primer on the metabolic bone diseases and disorders on mineral 
metabolism Washington D.C: The American Society for Bone and Mineral Research; 2003. 
p. 13-28.</source>
</element-citation>
            </ref>
            <ref id="B19"><label>19</label>
				<element-citation>
					<person-group person-group-type="author">
						<name>
							<surname>Pittenger</surname>
							<given-names>MF</given-names>
                            </name><name>
                            <surname>Mackay</surname>
							<given-names>AM</given-names>
                            </name><name>
                            <surname>Beck</surname>
							<given-names>SC</given-names>
                            </name><name>
                            <surname>Jaiswal</surname>
							<given-names>RK</given-names>
                            </name><name>
                            <surname>Douglas</surname>
							<given-names>R</given-names>
                            </name><name>
                            <surname>Mosca</surname>
							<given-names>JD</given-names>
                            </name><name>
                            <surname>Moorman</surname>
							<given-names>MA</given-names>
                            </name><name>
                            <surname>Simonetti</surname>
							<given-names>DW</given-names>
                            </name><name>
                            <surname>Craig</surname>
							<given-names>S</given-names>
                            </name><name>
                            <surname>Marshak</surname>
							<given-names>DR</given-names>
						</name>
					</person-group>
					<source>Multilineage potential 
of adult human mesenchymal stem cells. Science. 1999 Apr 2;284(5411):143-7.</source>
					<pub-id pub-id-type="pmid">10102814</pub-id> 
<pub-id pub-id-type="doi">10.1126/science.284.5411.143</pub-id>
</element-citation>
            </ref>
            <ref id="B20"><label>20</label>
				<element-citation>
					<person-group person-group-type="author">
						<name>
							<surname>Jin</surname>
							<given-names>HJ</given-names>
                            </name><name>
                            <surname>Park</surname>
							<given-names>SK</given-names>
                            </name><name>
                            <surname>Oh</surname>
							<given-names>W</given-names>
                            </name><name>
                            <surname>Yang</surname>
							<given-names>YS</given-names>
                            </name><name>
                            <surname>Kim</surname>
							<given-names>SW</given-names>
                            </name><name>
                            <surname>Choi</surname>
							<given-names>SJ</given-names>
						</name>
					</person-group>
					<source>Down-regulation 
of CD105 is associated with multi-lineage differentiation in human umbilical cord 
blood-derived mesenchymal stem cells. Biochem Biophys Res Commun. 2009 Apr 17;381(4):676-81. 
Epub 2009 Feb 27.</source>
					<pub-id pub-id-type="pmid">19250924</pub-id> 
<pub-id pub-id-type="doi">10.1016/j.bbrc.2009.02.118</pub-id>
</element-citation>
            </ref>
            <ref id="B21"><label>21</label>
				<element-citation>
					<person-group person-group-type="author">
						<name>
							<surname>Barry</surname>
							<given-names>FP</given-names>
                            </name><name>
                            <surname>Boynton</surname>
							<given-names>RE</given-names>
                            </name><name>
                            <surname>Haynesworth</surname>
							<given-names>S</given-names>
                            </name><name>
                            <surname>Murphy</surname>
							<given-names>JM</given-names>
                            </name><name>
                            <surname>Zaia</surname>
							<given-names>J</given-names>
						</name>
					</person-group>
					<source>The monoclonal antibody SH-2, raised against human mesenchymal stem cells, recognizes 
an epitope on endoglin (CD105). Biochem Biophys Res Commun. 1999 Nov;265(1):134-9.</source>
					<pub-id pub-id-type="pmid">10548503</pub-id> 
<pub-id pub-id-type="doi">10.1006/bbrc.1999.1620</pub-id>
</element-citation>
            </ref>
            <ref id="B22"><label>22</label>
				<element-citation>
					<person-group person-group-type="author">
						<name>
							<surname>Jakob</surname>
							<given-names>M</given-names>
                            </name><name>
                            <surname>Démarteau</surname>
							<given-names>O</given-names>
                            </name><name>
                            <surname>Schäfer</surname>
							<given-names>D</given-names>
                            </name><name>
                            <surname>Hintermann</surname>
							<given-names>B</given-names>
                            </name><name>
                            <surname>Dick</surname>
							<given-names>W</given-names>
                            </name><name>
                            <surname>Heberer</surname>
							<given-names>M</given-names>
                            </name><name>
                            <surname>Martin</surname>
							<given-names>I</given-names>
						</name>
					</person-group>
					<source>Specific growth factors during the expansion and redifferentiation 
of adult human articular chondrocytes enhance chondrogenesis and cartilaginous tissue 
formation in vitro. J Cell Biochem. 2001 Mar 26;81(2):368-77.</source>
					<pub-id pub-id-type="pmid">11241676</pub-id> 
<pub-id pub-id-type="doi">10.1002/1097-4644(20010501)81:2%3C368::AID-JCB1051%3E3.0.CO;2-J</pub-id>
</element-citation>
            </ref>
            <ref id="B23"><label>23</label>
				<element-citation>
					<person-group person-group-type="author">
						<name>
							<surname>Haynesworth</surname>
							<given-names>SE</given-names>
                            </name><name>
                            <surname>Baber</surname>
							<given-names>MA</given-names>
                            </name><name>
                            <surname>Caplan</surname>
							<given-names>AI</given-names>
						</name>
					</person-group>
					<source>Cell surface 
antigens on human marrow-derived mesenchymal cells are detected by monoclonal antibodies. 
Bone. 1992;13(1):69-80.</source>
					<pub-id pub-id-type="pmid">1316137</pub-id>
</element-citation>
            </ref>
            <ref id="B24"><label>24</label>
				<element-citation>
					<person-group person-group-type="author">
						<name>
							<surname>Kim</surname>
							<given-names>IS</given-names>
                            </name><name>
                            <surname>Song</surname>
							<given-names>YM</given-names>
                            </name><name>
                            <surname>Cho</surname>
							<given-names>TH</given-names>
                            </name><name>
                            <surname>Park</surname>
							<given-names>YD</given-names>
                            </name><name>
                            <surname>Lee</surname>
							<given-names>KB</given-names>
                            </name><name>
                            <surname>Noh</surname>
							<given-names>I</given-names>
                            </name><name>
                            <surname>Weber</surname>
							<given-names>F</given-names>
                            </name><name>
                            <surname>Hwang</surname>
							<given-names>SJ</given-names>
						</name>
					</person-group>
					<source>In vitro response of primary human bone marrow stromal cells to recombinant 
human bone morphogenic protein-2 in the early and late stages of osteoblast differentiation. 
Dev Growth Differ. 2008 Sep;50(7):553-64.</source>
					<pub-id pub-id-type="pmid">19238726</pub-id>
<pub-id pub-id-type="doi">10.1111/j.1440-169X.2008.01052.x</pub-id>
</element-citation>
            </ref>
            <ref id="B25"><label>25</label>
				<element-citation>
					<person-group person-group-type="author">
						<name>
							<surname>Leboy</surname>
							<given-names>PS</given-names>
                            </name><name>
                            <surname>Beresford</surname>
							<given-names>JN</given-names>
                            </name><name>
                            <surname>Devlin</surname>
							<given-names>C</given-names>
                            </name><name>
                            <surname>Owen</surname>
							<given-names>ME</given-names>
						</name>
					</person-group>
					<source>Dexamethasone 
induction of osteoblast mRNAs in rat marrow stromal cell cultures. J Cell Physiol. 
1991 Mar;146(3):370-8.</source>
					<pub-id pub-id-type="pmid">2022691</pub-id>
</element-citation>
            </ref>
            <ref id="B26"><label>26</label>
				<element-citation>
					<person-group person-group-type="author">
						<name>
							<surname>Beresford</surname>
							<given-names>JN</given-names>
                            </name><name>
                            <surname>Joyner</surname>
							<given-names>CJ</given-names>
                            </name><name>
                            <surname>Devlin</surname>
							<given-names>C</given-names>
                            </name><name>
                            <surname>Triffitt</surname>
							<given-names>JT</given-names>
						</name>
					</person-group>
					<source>The 
effects of dexamethasone and 1,25-dihydroxyvitamin D3 on osteogenic differentiation 
of human marrow stromal cells in vitro. Arch Oral Biol. 1994 Nov;39(11):941-7.</source>
					<pub-id pub-id-type="pmid">7695507</pub-id> 
<pub-id pub-id-type="doi">10.1016/0003-9969(94)90077-9</pub-id>
</element-citation>
            </ref>
            <ref id="B27"><label>27</label>
				<element-citation>
					<person-group person-group-type="author">
						<name>
							<surname>Balk</surname>
							<given-names>ML</given-names>
                            </name><name>
                            <surname>Bray</surname>
							<given-names>J</given-names>
                            </name><name>
                            <surname>Day</surname>
							<given-names>C</given-names>
                            </name><name>
                            <surname>Epperly</surname>
							<given-names>M</given-names>
                            </name><name>
                            <surname>Greenberger</surname>
							<given-names>J</given-names>
                            </name><name>
                            <surname>Evans</surname>
							<given-names>CH</given-names>
                            </name><name>
                            <surname>Niyibizi</surname>
							<given-names>C</given-names>
						</name>
					</person-group>
					<source>Effect of rhBMP-2 on the osteogenic potential of bone marrow 
stromal cells from an osteogenesis imperfecta mouse (oim). Bone. 1997 Jul;21(1):7-15.</source>
					<pub-id pub-id-type="pmid">9213002</pub-id> 
<pub-id pub-id-type="doi">10.1016/s8756-3282(97)00075-6</pub-id>
</element-citation>
            </ref>
            <ref id="B28"><label>28</label>
				<element-citation>
					<person-group person-group-type="author">
						<name>
							<surname>Diefenderfer</surname>
							<given-names>DL</given-names>
                            </name><name>
                            <surname>Osyczka</surname>
							<given-names>AM</given-names>
                            </name><name>
                            <surname>Garino</surname>
							<given-names>JP</given-names>
                            </name><name>
                            <surname>Leboy</surname>
							<given-names>PS</given-names>
						</name>
					</person-group>
					<source>
Regulation of BMP-induced transcription in cultured human bone marrow stromal cells. 
J Bone Joint Surg Am. 2003;85-A Suppl 3:19-28.</source>
					<pub-id pub-id-type="pmid">12925605</pub-id> 
                    <pub-id pub-id-type="pmcid">PMC1351076</pub-id>
</element-citation>
            </ref>
            <ref id="B29"><label>29</label>
				<element-citation>
					<person-group person-group-type="author">
						<name>
							<surname>McCabe</surname>
							<given-names>LR</given-names>
                            </name><name>
                            <surname>Banerjee</surname>
							<given-names>C</given-names>
                            </name><name>
                            <surname>Kundu</surname>
							<given-names>R</given-names>
                            </name><name>
                            <surname>Harrison</surname>
							<given-names>RJ</given-names>
                            </name><name>
                            <surname>Dobner</surname>
							<given-names>PR</given-names>
                            </name><name>
                            <surname>Stein</surname>
							<given-names>JL</given-names>
                            </name><name>
                            <surname>Lian</surname>
							<given-names>JB</given-names>
                            </name><name>
                            <surname>Stein</surname>
							<given-names>GS</given-names>
						</name>
					</person-group>
					<source>Developmental expression and activities of specific 
fos and jun proteins are functionally related to osteoblast maturation: role of 
Fra-2 and Jun D during differentiation. Endocrinology. 1996 Oct;137(10):4398-408.</source>
					<pub-id pub-id-type="pmid">8828501</pub-id>
</element-citation>
            </ref>
            <ref id="B30"><label>30</label>
				<element-citation>
					<person-group person-group-type="author">
						<name>
							<surname>Kim</surname>
							<given-names>JM</given-names>
                            </name><name>
                            <surname>Lee</surname>
							<given-names>SU</given-names>
                            </name><name>
                            <surname>Kim</surname>
							<given-names>YS</given-names>
                            </name><name>
                            <surname>Min</surname>
							<given-names>YK</given-names>
                            </name><name>
                            <surname>Kim</surname>
							<given-names>SH</given-names>
						</name>
					</person-group>
					<source>Baicalein 
stimulates osteoblast differentiation via coordinating activation of MAP kinases 
and transcription factors. J Cell Biochem. 2008 Aug 1;104(5):1906-17.</source>
					<pub-id pub-id-type="pmid">18384125</pub-id> 
<pub-id pub-id-type="doi">10.1002/jcb.21760</pub-id>
      </element-citation>
    </ref>
  </ref-list>
</back>
</article>
